Top » Catalog » SNPs » Y23073

$18.00

Y23073
[Y23073]

Y23073
hg38 Position: ChrY:10000811..10000811
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below DF105 > A10526
Forward Primer: Y23073_F CCAGTCTCCTAGAGCGTCCTG
Reverse Primer: Y23073_R TCTTCCCAATTACTGGAGTTGAG
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS439
DYS439
A12584
A12584
DYS390
DYS390
A12583
A12583
Y23075
Y23075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies