Top » Catalog » SNPs » Y23073

$18.00

Y23073
[Y23073]

Y23073
hg38 Position: ChrY:10000811..10000811
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below DF105 > A10526
Forward Primer: Y23073_F CCAGTCTCCTAGAGCGTCCTG
Reverse Primer: Y23073_R TCTTCCCAATTACTGGAGTTGAG
Reviews

Customers who bought this product also purchased
DYS439
DYS439
CDY
CDY
A10526
A10526
Y22118
Y22118
DYS607
DYS607
R1b-A10526 John-Cryans-Lindsey-Bellah Panel
R1b-A10526 John-Cryans-Lindsey-Bellah Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies