Top » Catalog » SNPs » CTS3859

$18.00

CTS3859
[CTS3859]

CTS3859
hg38 Position: ChrY:13117078..13117078
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3859_F CTGTCTGCCATCACCCG
Reverse Primer: CTS3859_R TTTTTAGTAGCTGTTTGAGTGTCCAG
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
FGC4290
FGC4290
ZS7299
ZS7299
FGC11
FGC11
FGC4480
FGC4480
ZS5010
ZS5010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies