Top » Catalog » SNPs » Z714

$18.00

Z714
[Z714]

Z714
hg38 Position: ChrY:15441530..15441530
Ancestral: C
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: T1a1a1b2b2 (not listed)
Comments: Extracted from 1000 genomes data. Below Z709 >Z712; aka FGC3993
Forward Primer: Z714_F AGAGTGCCCACAACAAAACC
Reverse Primer: Z714_R AAGACCCACTGGCTGACATC
Reviews

Customers who bought this product also purchased
CTS6507
CTS6507
FGC30201
FGC30201
M70
M70
CTS9882
CTS9882
CTS6280
CTS6280
T Superclade Panel
T Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies