Top » Catalog » SNPs » Z714

$18.00

Z714
[Z714]

Z714
hg38 Position: ChrY:15441530..15441530
Ancestral: C
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: T1a1a1b2b2 (not listed)
Comments: Extracted from 1000 genomes data. Below Z709 >Z712; aka FGC3993
Forward Primer: Z714_F AGAGTGCCCACAACAAAACC
Reverse Primer: Z714_R AAGACCCACTGGCTGACATC
Reviews

Customers who bought this product also purchased
FGC30207
FGC30207
Y11596
Y11596
CTS11451
CTS11451
CTS6507
CTS6507
FGC30201
FGC30201
M70
M70
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies