Top » Catalog » SNPs » ZS9615

$19.00

ZS9615
[ZS9615]

ZS9615
hg38 Position: ChrY:13549697..13549697
Ancestral: T
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream CTS9501
Forward Primer: ZS9615_F ACAGAATCAGAGGCCAGAGG
Reverse Primer: ZS9615_R GATGTATTACTGTTCGCAATAGCC
Reviews

Customers who bought this product also purchased
HU406
HU406
Y154840
Y154840
FT254568
FT254568
A27560
A27560
FGC64425
FGC64425
FGC64422
FGC64422
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies