Top » Catalog » SNPs » A12541

$18.00

A12541
[A12541]

A12541
hg38 Position: ChrY:17093496..17093496
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below FGC11388
Forward Primer: A12541_F TTGTTTCCTGCTTGTTTGTTC
Reverse Primer: A12541_R AAAAGTTCAGGCCACAGCAG
Reviews

Customers who bought this product also purchased
R1b Rox2 Hickey Segregation Panel
R1b Rox2 Hickey Segregation Panel
A12570
A12570
A12543
A12543
A12542
A12542
A15481
A15481
A12540
A12540
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies