Top » Catalog » SNPs » A12542

$18.00

A12542
[A12542]

A12542
HG19 Position: ChrY:19638513..19638513
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below FGC11388
Forward Primer: A12542_F ACCCAGTGTTCCAGCTTTTC
Reverse Primer: A12542_R AGATGCCAACCAGCAAAGTC
Reviews

Customers who bought this product also purchased
A12541
A12541
A15481
A15481
A12540
A12540
A15480
A15480
A12539
A12539
A15479
A15479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies