Top » Catalog » SNPs » FGC6778

$18.00

FGC6778
[FGC6778]

FGC6778
hg38 Position: ChrY:19136583..19136583
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC2 > FGC6770
Forward Primer: FGC6778_F ACAGGATGGAGAACCAATCG
Reverse Primer: FGC6778_R GCCACCTCCTTGAGTTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies