Top » Catalog » SNPs » CTS3119

$18.00

CTS3119
[CTS3119]

CTS3119
hg38 Position: ChrY:12560027..12560027
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Below U175 > U209 > M4232 > Z1720 > M4041 > Z1788
Forward Primer: CTS3119_F TGTATAGAATGATTGGTGATGACCC
Reverse Primer: CTS3119_R CCTCAAACCGCCATCCTG
Reviews

Customers who bought this product also purchased
V2580
V2580
M215
M215
L608
L608
M3907
M3907
E Superclade Panel
E Superclade Panel
Y65944
Y65944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies