Top » Catalog » SNPs » A12591

$18.00

A12591
[A12591]

A12591
hg38 Position: ChrY:8769347..8769347
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream A761
Forward Primer: A12591_F TCCTTAGGGATTTCGTGGTG
Reverse Primer: A12591_R AGTGGGACTTGACCATGGAG
Reviews

Customers who bought this product also purchased
A195
A195
A88
A88
A761
A761
Z16254
Z16254
A11843
A11843
R1b-A761 Panel
R1b-A761 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies