Top » Catalog » SNPs » Y878

$18.00

Y878
[Y878]

Y878
hg38 Position: ChrY:15182820..15182820
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a1a (not listed)
Comments: Below L657 > Y7 > Y879
Forward Primer: Y878_F TCTCATGACTCCATGGCAAG
Reverse Primer: Y878_R CATCTTTTGCATTCCTGTGG
Reviews

Customers who bought this product also purchased
A195
A195
A88
A88
A761
A761
Z16254
Z16254
A11843
A11843
R1b-A761 Panel
R1b-A761 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies