Top » Catalog » SNPs » Y878

$18.00

Y878
[Y878]

Y878
hg38 Position: ChrY:15182820..15182820
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a1a (not listed)
Comments: Below L657 > Y7 > Y879
Forward Primer: Y878_F TCTCATGACTCCATGGCAAG
Reverse Primer: Y878_R CATCTTTTGCATTCCTGTGG
Reviews

Customers who bought this product also purchased
A195
A195
A88
A88
A761
A761
Z16254
Z16254
A11843
A11843
A12594
A12594
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies