Top » Catalog » SNPs » M223

$18.00

M223
[M223]

M223
hg38 Position: ChrY:19555421..19555421
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: I2a2a
Comments: A8.05e
Forward Primer: M223_F TGGCTCATGTTGCTTGAGTTC
Reverse Primer: M223_R ACTGATTCAGTAAATCTCCTAACTTTGC
Reviews

Customers who bought this product also purchased
L801
L801
Y5282
Y5282
HVR2
HVR2
HVR1
HVR1
CTS1977
CTS1977
Y183467
Y183467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies