Top » Catalog » SNPs » M223

$18.00

M223
[M223]

M223
hg38 Position: ChrY:19555421..19555421
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: I2a2a
Comments: A8.05e
Forward Primer: M223_F TGGCTCATGTTGCTTGAGTTC
Reverse Primer: M223_R ACTGATTCAGTAAATCTCCTAACTTTGC
Reviews

Customers who bought this product also purchased
A1328
A1328
CTS595
CTS595
Y16473
Y16473
M253
M253
A10230
A10230
A7358
A7358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies