$19.00

rs115117205
[rs115117205]

rs115117205
hg38 Position: Chr3:161409558..161409558
Ancestral: G
Derived: A
Reference: dbSNP
ISOGG Haplogroup: none
Comments: .
Forward Primer: rs115117205_F ATGTTGCCCCCTTATGGAAC
Reverse Primer: rs115117205_R TGCTACAACCACCGCTACTG
Reviews

Customers who bought this product also purchased
HVR2
HVR2
HVR1
HVR1
rs78541969
rs78541969
rs77345130
rs77345130
rs116562818
rs116562818
rs114909126
rs114909126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies