Top » Catalog » SNPs » rs77345130

$19.00

rs77345130
[rs77345130]

rs77345130
hg38 Position: Chr3:163408899..163408899
Ancestral: T
Derived: C
Reference: dbSNP
ISOGG Haplogroup: none
Comments: .
Forward Primer: rs77345130_F GCCATGTGATGATGTACTTGCTC
Reverse Primer: rs77345130_R CATGGGTTGATGGGAAAATC
Reviews

Customers who bought this product also purchased
HVR2
HVR2
HVR1
HVR1
rs114909126
rs114909126
rs116562818
rs116562818
rs115104025
rs115104025
rs79079433
rs79079433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies