Top » Catalog » SNPs » rs79079433

$19.00

rs79079433
[rs79079433]

rs79079433
hg38 Position: Chr3:154992820..154992820
Ancestral: A
Derived: G
Reference: dbSNP
ISOGG Haplogroup: none
Comments: .
Forward Primer: rs79079433_F TGACAATACTACTCAAAGAAATCTATAGATACAG
Reverse Primer: rs79079433_R GATGGCTTCCTTTCTGTGCAG
Reviews

Customers who bought this product also purchased
HVR2
HVR2
HVR1
HVR1
rs115104025
rs115104025
rs12487205
rs12487205
rs113558962
rs113558962
rs115117205
rs115117205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies