Top » Catalog » SNPs » ZS241

$18.00

ZS241
[ZS241]

ZS241
hg38 Position: ChrY:8611085..8611085
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: J1 (not listed)
Comments: Kohanim subclades of J1. downstream L147.1
Forward Primer: ZS241_F AATAAGGTAAGATAGGGGTGAGAATATG
Reverse Primer: ZS241_R AGCCATCAAAACATGAAAGTATTTG
Reviews

Customers who bought this product also purchased
Y138150
Y138150
Y16646
Y16646
Y136125
Y136125
M96
M96
ZS3698
ZS3698
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies