Top » Catalog » SNPs » ZS241

$18.00

ZS241
[ZS241]

ZS241
HG19 Position: ChrY:8611085..8611085
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: J1 (not listed)
Comments: Kohanim subclades of J1. downstream L147.1
Forward Primer: ZS241_F AATAAGGTAAGATAGGGGTGAGAATATG
Reverse Primer: ZS241_R AGCCATCAAAACATGAAAGTATTTG
Reviews

Customers who bought this product also purchased
ZS6262
ZS6262
FGC4726
FGC4726
FGC4737
FGC4737
M267
M267
FGC4745
FGC4745
ZS237
ZS237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies