Top » Catalog » SNPs » ZS241

$18.00

ZS241
[ZS241]

ZS241
HG19 Position: ChrY:8611085..8611085
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: J1 (not listed)
Comments: Kohanim subclades of J1. downstream L147.1
Forward Primer: ZS241_F AATAAGGTAAGATAGGGGTGAGAATATG
Reverse Primer: ZS241_R AGCCATCAAAACATGAAAGTATTTG
Reviews

Customers who bought this product also purchased
FGC12
FGC12
FGC5
FGC5
ZS6205
ZS6205
ZS6359
ZS6359
ZS6165
ZS6165
FGC4737
FGC4737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies