Top » Catalog » SNPs » ZS4753

$18.00

ZS4753
[ZS4753]

ZS4753
hg38 Position: ChrY:2829211..2829211
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4316; Found in Big Y sample M9483
Forward Primer: ZS4753_F ACCTAACAAATGATGCCTTTCAG
Reverse Primer: ZS4753_R AGAGCATGCTGTCTTTGATGTAAG
Reviews

Customers who bought this product also purchased
BY166426
BY166426
FT126454
FT126454
ALK121
ALK121
Z20775
Z20775
M35
M35
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies