Top » Catalog » SNPs » ZS4753

$18.00

ZS4753
[ZS4753]

ZS4753
HG19 Position: ChrY:2829211..2829211
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4316; Found in Big Y sample M9483
Forward Primer: ZS4753_F ACCTAACAAATGATGCCTTTCAG
Reverse Primer: ZS4753_R AGAGCATGCTGTCTTTGATGTAAG
Reviews

Customers who bought this product also purchased
FGC2
FGC2
FGC1696
FGC1696
FGC4316
FGC4316
FGC1713
FGC1713
ZS4756
ZS4756
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies