Top » Catalog » SNPs » ZS4753

$18.00

ZS4753
[ZS4753]

ZS4753
hg38 Position: ChrY:2829211..2829211
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4316; Found in Big Y sample M9483
Forward Primer: ZS4753_F ACCTAACAAATGATGCCTTTCAG
Reverse Primer: ZS4753_R AGAGCATGCTGTCTTTGATGTAAG
Reviews

Customers who bought this product also purchased
Z20777
Z20777
ZS5804
ZS5804
Y164628
Y164628
BY195383
BY195383
FT44221
FT44221
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies