Top » Catalog » SNPs » ZS4753

$18.00

ZS4753
[ZS4753]

ZS4753
hg38 Position: ChrY:2829211..2829211
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4316; Found in Big Y sample M9483
Forward Primer: ZS4753_F ACCTAACAAATGATGCCTTTCAG
Reverse Primer: ZS4753_R AGAGCATGCTGTCTTTGATGTAAG
Reviews

Customers who bought this product also purchased
FGC40709
FGC40709
FT43313
FT43313
FGC16651
FGC16651
FGC38802
FGC38802
L858
L858
FT157054
FT157054
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies