Top » Catalog » SNPs » Y20566

$18.00

Y20566
[Y20566]

Y20566
HG19 Position: ChrY:13203985..13203985
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2 (not listed)
Comments: Below Y20306
Forward Primer: Y20566_F CAAGTCATAGGCACTGAAATTACC
Reverse Primer: Y20566_R GTCCCCAGCAAGCTGTTTAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies