Top » Catalog » SNPs » Z17274

$18.00

Z17274
[Z17274]

Z17274
hg38 Position: ChrY:8537232..8537232
Ancestral: A
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: beneath DF88. approx. with Z17267
Forward Primer: Z17274_F ACTTGGTTACAACTGGTTTTAGAACTG
Reverse Primer: Z17274_R CCGTACCTGGTAACTGGAGC
Reviews

Customers who bought this product also purchased
BZ3279
BZ3279
DYS460
DYS460
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies