Top » Catalog » SNPs » A1721

$19.00

A1721
[A1721]

A1721
hg38 Position: ChrY:16893730..16893730
Ancestral: T
Derived: C
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1721_F AGCCTCAAGAATGTGTCAAGC
Reverse Primer: A1721_R CAAAATGATGACATTGCCAAAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies