Top » Catalog » SNPs » S1393

$18.00

S1393
[S1393]

S1393
hg38 Position: ChrY:11906288..11906288
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream Z21380
Forward Primer: S1393_F ATAGATACCCTAAAGGCTAGATGGATG
Reverse Primer: S1393_R GAATGGATGAAAGATGGATACATAAG
Reviews

Customers who bought this product also purchased
S4268
S4268
L719
L719
Z21280
Z21280
DF19
DF19
Z21380
Z21380
BY19349
BY19349
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies