Top » Catalog » SNPs » S1393

$18.00

S1393
[S1393]

S1393
hg38 Position: ChrY:11906288..11906288
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream Z21380
Forward Primer: S1393_F ATAGATACCCTAAAGGCTAGATGGATG
Reverse Primer: S1393_R GAATGGATGAAAGATGGATACATAAG
Reviews

Customers who bought this product also purchased
Z27260
Z27260
Z41640
Z41640
BY162529
BY162529
Z17125
Z17125
S1398
S1398
S18811
S18811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies