Top » Catalog » SNPs » S1393

$18.00

S1393
[S1393]

S1393
hg38 Position: ChrY:11906288..11906288
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream Z21380
Forward Primer: S1393_F ATAGATACCCTAAAGGCTAGATGGATG
Reverse Primer: S1393_R GAATGGATGAAAGATGGATACATAAG
Reviews

Customers who bought this product also purchased
Z17125
Z17125
S1398
S1398
S18811
S18811
S17075
S17075
Y13836
Y13836
Z43162
Z43162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies