Top » Catalog » SNPs » S17075

$19.00

S17075
[S17075]

S17075
hg38 Position: ChrY:13281545..13281545
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream S8137
Forward Primer: S17075_F CAGGAGTAATTCCTTTTCCATAAC
Reverse Primer: S17075_R GACTTGCCCTACGCTGAAAG
Reviews

Customers who bought this product also purchased
Z40132
Z40132
Z39869
Z39869
DF88
DF88
Z43162
Z43162
BY19349
BY19349
Y13836
Y13836
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies