Top » Catalog » SNPs » S17075

$18.00

S17075
[S17075]

S17075
hg38 Position: ChrY:13281545..13281545
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream S8137
Forward Primer: S17075_F CAGGAGTAATTCCTTTTCCATAAC
Reverse Primer: S17075_R GACTTGCCCTACGCTGAAAG
Reviews

Customers who bought this product also purchased
P312
P312
Z29034
Z29034
U152
U152
Z17316
Z17316
DYS390
DYS390
Z17125
Z17125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies