Top » Catalog » SNPs » S17075

$18.00

S17075
[S17075]

S17075
HG19 Position: ChrY:13281545..13281545
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream S8137
Forward Primer: S17075_F CAGGAGTAATTCCTTTTCCATAAC
Reverse Primer: S17075_R GACTTGCCCTACGCTGAAAG
Reviews

Customers who bought this product also purchased
Z17316
Z17316
DYS390
DYS390
Z17125
Z17125
YSEQ-Alpha
YSEQ-Alpha
S7449
S7449
Z40619
Z40619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies