Top » Catalog » SNPs » S17075

$18.00

S17075
[S17075]

S17075
HG19 Position: ChrY:13281545..13281545
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream S8137
Forward Primer: S17075_F CAGGAGTAATTCCTTTTCCATAAC
Reverse Primer: S17075_R GACTTGCCCTACGCTGAAAG
Reviews

Customers who bought this product also purchased
Z40619
Z40619
DF19
DF19
Z17126
Z17126
P312
P312
Z29034
Z29034
U152
U152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies