Top » Catalog » SNPs » Z17125

$18.00

Z17125
[Z17125]

Z17125
HG19 Position: ChrY:12143544..12143544
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: beneath Z17112. approx. with Z17123
Forward Primer: Z17125_F AAGCCACCATGCCTGGC
Reverse Primer: Z17125_R GGGTTATAATATAGAACTGCAGTTCTGG
Reviews

Customers who bought this product also purchased
Z39823
Z39823
Z39228
Z39228
Z29047
Z29047
Z27260
Z27260
S4268
S4268
Z40804
Z40804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies