Top » Catalog » SNPs » Z17125

$18.00

Z17125
[Z17125]

Z17125
hg38 Position: ChrY:12143544..12143544
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: beneath Z17112. approx. with Z17123
Forward Primer: Z17125_F AAGCCACCATGCCTGGC
Reverse Primer: Z17125_R GGGTTATAATATAGAACTGCAGTTCTGG
Reviews

Customers who bought this product also purchased
Z17316
Z17316
DYS390
DYS390
S17075
S17075
YSEQ-Alpha
YSEQ-Alpha
S7449
S7449
Z40619
Z40619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies