Top » Catalog » SNPs » Z17125

$18.00

Z17125
[Z17125]

Z17125
hg38 Position: ChrY:12143544..12143544
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: beneath Z17112. approx. with Z17123
Forward Primer: Z17125_F AAGCCACCATGCCTGGC
Reverse Primer: Z17125_R GGGTTATAATATAGAACTGCAGTTCTGG
Reviews

Customers who bought this product also purchased
BY19349
BY19349
Y13836
Y13836
S1393
S1393
BY162529
BY162529
S18811
S18811
Z43162
Z43162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies