Top » Catalog » SNPs » Z21280

$18.00

Z21280
[Z21280]

Z21280
hg38 Position: ChrY:22252429..22252429
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b1a2a1a2e (not listed)
Comments: beneath Z17112 approx. with Z21278
Forward Primer: Z21280_F GAGTATAGGGAGACAGTGTTTTAGCC
Reverse Primer: Z21280_R GAATGATACTCTACTAGCAGCCCC
Reviews

Customers who bought this product also purchased
S1398
S1398
Z17125
Z17125
Z27260
Z27260
S17075
S17075
Z41635
Z41635
S4268
S4268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies