Top » Catalog » SNPs » Z21380

$18.00

Z21380
[Z21380]

Z21380
hg38 Position: ChrY:13465128..13465130
Ancestral: ins
Derived: del
Reference: Y DNA community
ISOGG Haplogroup: R1b1a2a1a2e (not listed)
Comments: beneath Z17112 approx. with S1388
Forward Primer: Z21380_F CGGGTGGATCATGAGGTC
Reverse Primer: Z21380_R TAGGCACATTGGCACATGAC
Reviews

Customers who bought this product also purchased
Z41640
Z41640
Z21280
Z21280
S1398
S1398
Z17125
Z17125
Z27260
Z27260
S17075
S17075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies