Top » Catalog » SNPs » Z21380

$18.00

Z21380
[Z21380]

Z21380
hg38 Position: ChrY:13465128..13465130
Ancestral: ins
Derived: del
Reference: Y DNA community
ISOGG Haplogroup: R1b1a2a1a2e (not listed)
Comments: beneath Z17112 approx. with S1388
Forward Primer: Z21380_F CGGGTGGATCATGAGGTC
Reverse Primer: Z21380_R TAGGCACATTGGCACATGAC
Reviews

Customers who bought this product also purchased
Y13836
Y13836
S1393
S1393
BY162529
BY162529
DF19
DF19
S18811
S18811
Z43162
Z43162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies