Top » Catalog » SNPs » A37576

$19.00

A37576
[A37576]

A37576
hg38 Position: ChrY:8806535..8806535
Ancestral: G
Derived: A
Reference: YSEQ (2023)
ISOGG Haplogroup: J1
Comments: Below BY2
Forward Primer: A37576_F AGATAGTTCACCAGTTCTTGTACATGTG
Reverse Primer: A37576_R GTCAAATCTGGTAGTCCTATGGC
Reviews

Customers who bought this product also purchased
FTA57881
FTA57881
A37578
A37578
A37577
A37577
ZS9753
ZS9753
J1 Amarna Panel
J1 Amarna Panel
Y545154
Y545154
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies