Top » Catalog » SNPs » A37577

$19.00

A37577
[A37577]

A37577
hg38 Position: ChrY:17101169..17101169
Ancestral: T
Derived: C
Reference: YSEQ (2023)
ISOGG Haplogroup: J1
Comments: Below BY2
Forward Primer: A37577_F GGAGAATTGTTGAAATAATCATATGG
Reverse Primer: A37577_R CCCATGTTGTGTTCAAGGATTG
Reviews

Customers who bought this product also purchased
J1 Amarna Panel
J1 Amarna Panel
Y545154
Y545154
FT263744
FT263744
FTA57881
FTA57881
A37578
A37578
A37576
A37576
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies