Top » Catalog » SNPs » A37578

$19.00

A37578
[A37578]

A37578
hg38 Position: ChrY:17354157..17354157
Ancestral: A
Derived: G
Reference: YSEQ (2023)
ISOGG Haplogroup: J1
Comments: Below BY2
Forward Primer: A37578_F CACTGCTGGCTTAGGTGTCC
Reverse Primer: A37578_R ACCCATCATTTCTTCGTTGC
Reviews

Customers who bought this product also purchased
A37576
A37576
ZS9753
ZS9753
J1 Amarna Panel
J1 Amarna Panel
Y545154
Y545154
FT263744
FT263744
FTA57881
FTA57881
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies