Top » Catalog » SNPs » FT177594

$19.00

FT177594
[FT177594]

FT177594
hg38 Position: ChrY:20700596..20700596
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT177594_F ACTGGAGGTTGGTTGTCCAG
Reverse Primer: FT177594_R ACCTCCCACTTGATTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies