Top » Catalog » SNPs » FT227705

$19.00

FT227705
[FT227705]

FT227705
hg38 Position: ChrY:26478763..26478763
Ancestral: A
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT227705_F TGCTTTTGCATGGAGGAAAG
Reverse Primer: FT227705_R TTTGTTTATCCATTCATCCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies