Top » Catalog » SNPs » A12919

$18.00

A12919
[A12919]

A12919
HG19 Position: ChrY:2955741..2955741
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12919_F TAATCCTTTTTGGCCTGTGG
Reverse Primer: A12919_R AAGTGGAGGGAAAGGAAAGG
Reviews

Customers who bought this product also purchased
A14638
A14638
FGC1713
FGC1713
ZS5814
ZS5814
FGC52345
FGC52345
FGC5
FGC5
ZS5801
ZS5801
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies