Top » Catalog » SNPs » A12921

$18.00

A12921
[A12921]

A12921
HG19 Position: ChrY:12651226..12651226
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A12921_F AGGTGGCAAATTACCAAAGC
Reverse Primer: A12921_R TTGATTGTATCCTCGCATTTTG
Reviews

Customers who bought this product also purchased
FGC42837
FGC42837
A12919
A12919
A14638
A14638
FGC52345
FGC52345
ZS5801
ZS5801
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies