Top » Catalog » SNPs » A12926

$17.50

A12926
[A12926]

A12926
HG19 Position: ChrY:19368778..19368778
Ancestral: G
Derived: A
Reference: Colin Ferguson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS4466 > FGC29289
Forward Primer: A12926_F GATTAAACCCATGACCCAGG
Reverse Primer: A12926_R AATTGTCCCCTCAAGCAGAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies