Top » Catalog » SNPs » CTS421

$18.00

CTS421
[CTS421]

CTS421
HG19 Position: ChrY:6875446..6875446
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a10
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS421_F TTCACCAAGGGACAACCTTC
Reverse Primer: CTS421_R CAAATACACCCTGGGTACTGC
Reviews

Customers who bought this product also purchased
Z21887
Z21887
Y4008
Y4008
Z1720
Z1720
M3951
M3951
Z1786
Z1786
U181
U181
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies