Top » Catalog » SNPs » CTS421

$18.00

CTS421
[CTS421]

CTS421
HG19 Position: ChrY:6875446..6875446
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a10
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS421_F TTCACCAAGGGACAACCTTC
Reverse Primer: CTS421_R CAAATACACCCTGGGTACTGC
Reviews

Customers who bought this product also purchased
Z1720
Z1720
Z21887
Z21887
Y4008
Y4008
U290
U290
Z5955
Z5955
E1b-U175 "Bantu Expansion" Panel
E1b-U175 "Bantu Expansion" Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies