Top » Catalog » SNPs » FGC29768

$17.50

FGC29768
[FGC29768]

FGC29768
HG19 Position: ChrY:13928290..13928290
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC29768_F GGGTACAGAGTTTCTGTTTCAAATG
Reverse Primer: FGC29768_R GACCCCTATCTCTATGAAAAGGAGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies