Top » Catalog » SNPs » BY711

$18.00

BY711
[BY711]

BY711
HG19 Position: ChrY:16715314..16715314
Ancestral: C
Derived: T
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Below DF63
Forward Primer: BY711_F GAGTTCTAGTTGCTCCAGATCTTTC
Reverse Primer: BY711_R GGTCATGGAAGCACACTCG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
R1b-DF63 Panel
R1b-DF63 Panel
DF13
DF13
DF63
DF63
BY709
BY709
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies