Top » Catalog » SNPs » FGC52664

$18.00

FGC52664
[FGC52664]

FGC52664
hg38 Position: ChrY:20850558..20850558
Ancestral: A
Derived: G
Reference: Full Genomes (2016)
ISOGG Haplogroup: G2a
Comments: .
Forward Primer: FGC52664_F TCTCAGCTGGAGCAGCATC
Reverse Primer: FGC52664_R AAGAACTTCACACTTGCACTGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
FGC41973
FGC41973
FGC52618
FGC52618
FGC52608
FGC52608
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies